Sequence ID | >WENV170646024 |
Genome ID | JQGF01010412 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 2 |
End posion on genome | 78 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
nnnnnnnnnt |
tRNA gene sequence |
CGGAGCATAGCACAGCCTGGTAGTGCACCTGGTTTGGGACCAGGGGGTCGTAGGTTCGAA |
Downstream region at tRNA end position |
attcttcaag |
Secondary structure (Cloverleaf model) | >WENV170646024 Pro TGG t ACCA attcttcaag C - G G - C G - C A - T G - C C - G A - T T A T C A T C C A C G A A | | | | | G C C A C G G T A G G C T | | | | T T G G T G C G T A A GGGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |