Sequence ID | >WENV170646025 |
Genome ID | JQGF01010412 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 124 |
End posion on genome | 200 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
catcggtcat |
tRNA gene sequence |
GCGCCTGTAGCTCAGTTGGATAGAGCATCCGCCTTCTAAGCGGATGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
tttagttggt |
Secondary structure (Cloverleaf model) | >WENV170646025 Arg TCT t GCCA tttagttggt G - C C - G G - C C - G C - G T - A G - C T A T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A A TGGTC T - A C - G C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |