Sequence ID | >WENV170646026 |
Genome ID | JQGF01010412 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 239 |
End posion on genome | 314 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaacgttatg |
tRNA gene sequence |
GTGGATGTAGCTCAGTTGGTAGAGCCCTGGATTGTGATTCCAGTTGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170646026 His GTG g CCCA nnnnnnnnnn G - C T - A G - C G + T A - T T - A G - C T A T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A C TTGTC C - G T - A G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |