Sequence ID | >WENV170646028 |
Genome ID | JQGF01011117 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 1457 |
End posion on genome | 1383 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tgcaagctac |
tRNA gene sequence |
GGGCGGTTAACTCAGTGGTAGAGTGCCACCTTCACACGGTGGAAGTCACAAGTTCGAACC |
Downstream region at tRNA end position |
tcttcgcttt |
Secondary structure (Cloverleaf model) | >WENV170646028 Val CAC c ACCA tcttcgcttt G - C G - C G - C C - G G - C G - C T - A C A T T G T T C A G A A | | | | | G T C T C A A C A A G C G | | | | T T G G A G T T A G AAGTC C - G C - G A - T C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |