Sequence ID | >WENV170646031 |
Genome ID | JQGF01011307 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 2889 |
End posion on genome | 2974 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aactcccgct |
tRNA gene sequence |
GCATCCATGGCGGAATTGGTAGACGCAAGGGACTTAAAATCCCTCGATCCTTGATCGTGC |
Downstream region at tRNA end position |
tatattctcg |
Secondary structure (Cloverleaf model) | >WENV170646031 Leu TAA t ACCA tatattctcg G - C C - G A - T T - A C - G C - G A - T T T T C G G C C A T A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G A CGATCCTTGATCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |