Sequence ID | >WENV170646032 |
Genome ID | JQGF01012192 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 58 |
End posion on genome | 133 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
agattgcgac |
tRNA gene sequence |
GCCCACGTAGCTCAGTCGGTAGAGCACGTTCTTGGTAAGAACGGGGTCATCGGTTCAAGT |
Downstream region at tRNA end position |
tattgaccct |
Secondary structure (Cloverleaf model) | >WENV170646032 Thr GGT c TCCA tattgaccct G - C C - G C - G C - G A - T C - G G - C T G T T A G C C A T G A A | | | | | A C C T C G A T C G G C G | | | | T T G G A G C T A A GGGTC C - G G - C T - A T - A C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |