Sequence ID | >WENV170646034 |
Genome ID | JQGF01012194 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 382 |
End posion on genome | 455 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gtctcccggt |
tRNA gene sequence |
GCGGGAGTAGTTCAATGGTAGAACTGTAGCCTTCCAAGCTACTAGTGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ctgaacgcca |
Secondary structure (Cloverleaf model) | >WENV170646034 Gly TCC t TCCA ctgaacgcca G - C C - G G - C G - C G - C A - T G - C T T T T G C C C A A A A + | | | | G T C T T G G C G G G C G | | | | T T G G A A C T A T TAGT G - C T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |