Sequence ID | >WENV170646036 |
Genome ID | JQGF01012333 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 159 |
End posion on genome | 83 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ggagcgcctt |
tRNA gene sequence |
CGGAGCGTGGCGCAGCCTGGTAGCGCACTTGACTGGGGGTCAAGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
tctaaatctt |
Secondary structure (Cloverleaf model) | >WENV170646036 Pro GGG t ACCA tctaaatctt C - G G - C G - C A - T G - C C - G G - C T A T T G T C C A C G A G + | | | | G C C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |