Sequence ID | >WENV170646044 |
Genome ID | JQGF01014744 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 638 |
End posion on genome | 727 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ttcaggtccc |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTTGAAGGAGCACGCCTGGAAAGTGTGTATACGTTTGCGCGTA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170646044 Ser GGA c GCCA nnnnnnnnnn G - C G - C A A G - C A - T G - C G + T T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T T A G G A T G A G TATACGTTTGCGCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |