Sequence ID | >WENV170646045 |
Genome ID | JQGF01014964 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 2 |
End posion on genome | 76 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
nnnnnnnnnc |
tRNA gene sequence |
GCGGGTATAGTTCAGAGGTAGAACGTCAGCTTCCCAAGCTGAATGTCGCGAGTTCGATTC |
Downstream region at tRNA end position |
atcatttcaa |
Secondary structure (Cloverleaf model) | >WENV170646045 Gly CCC c TCCA atcatttcaa G - C C - G G - C G - C G - C T - A A - T T T T C G C T C A G A A | | | | | G A C T T G G C G A G C G | | | | T T G G A A C T A G ATGTC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |