Sequence ID | >WENV170646046 |
Genome ID | JQGF01015347 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 104 |
End posion on genome | 180 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tacttatgtc |
tRNA gene sequence |
GCGCTCATAGCTCAGCTGGATAGAGCACTTGGCTACGAACTAAGGGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
ataagtaaac |
Secondary structure (Cloverleaf model) | >WENV170646046 Arg ACG c ACCA ataagtaaac G - C C - G G - C C - G T - A C - G A - T T A T C T C T C A C G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C A T A A GGGTC C - G T - A T - A G + T G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |