Sequence ID | >WENV170646047 |
Genome ID | JQGF01015360 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 287 |
End posion on genome | 363 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaccggctcg |
tRNA gene sequence |
GGGCCTGTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGACGTTCGAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170646047 Ile GAT g ACCA nnnnnnnnnn G - C G - C G - C C - G C - G T - A G - C T G T C C T G C A G G A A | | | | | G T C T C G G G A C G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |