Sequence ID | >WENV170646049 |
Genome ID | JQGF01015465 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 200 |
End posion on genome | 125 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
actttcgtgt |
tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACATTACCCTTTCACGGTAGCGACCGGGGTTCGAAT |
Downstream region at tRNA end position |
agccttccag |
Secondary structure (Cloverleaf model) | >WENV170646049 Glu TTC t GCCA agccttccag G - C T - A C - G C - G C - G C - G A - T T A T G C C C C A A G A C | | | | | G G T C T G C G G G G C G + | | | T T C G G A C C T A A CGAC T + G T - A A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |