Sequence ID | >WENV170646051 |
Genome ID | JQGF01015521 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 791 |
End posion on genome | 716 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GCGGCTGTAGCTCAGTGGATAGAGTATTGGCCTCCGAAGCCAAGGGTCGTGGGTTCGATC |
Downstream region at tRNA end position |
cctcaatgac |
Secondary structure (Cloverleaf model) | >WENV170646051 Arg CCG n GCCA cctcaatgac G - C C - G G - C G - C C - G T - A G - C C T T C G C C C A T G A A | + | | | G G C T C G G T G G G C G | | | + T T A G A G T T A A GGGTC T - A T - A G - C G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |