Sequence ID | >WENV170646059 |
Genome ID | JQGF01020671 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 114 |
End posion on genome | 40 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
tggcattaag |
tRNA gene sequence |
GCTCCCGTAGCACAAGGGTCAGGGCAGCCGACTTATAATCGGTCGATCCAGGTTCGATTC |
Downstream region at tRNA end position |
tttatcacat |
Secondary structure (Cloverleaf model) | >WENV170646059 Ile TAT g ACCA tttatcacat G - C C - G T - A C - G C - G C - G G - C T T T G G T C C A G A A A | | | | | G G C A C G C C A G G C G | | | T T T G G G C C A A CGAT G + T C - G C - G G - C A - T C A T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |