Sequence ID | >WENV170646063 |
Genome ID | JQGF01021419 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 198 |
End posion on genome | 272 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttaattagtt |
tRNA gene sequence |
CGGGGAGTAGTTAAGTTGGCTATAACGCTTGGTTTGGGACCAAGAGGCCGGAGGTTCGAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170646063 Pro TGG t ACnn nnnnnnnnnn C - G G - C G - C G - C G - C A - T G - C T G T T C T C C A T G A A + | | | | G T A T T G G G A G G C G | | | | T T G T A A C C T A G AGGCC C - G T - A T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |