Sequence ID | >WENV170646066 |
Genome ID | JQGF01027559 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 168 |
End posion on genome | 95 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tttcttgctt |
tRNA gene sequence |
TGGGGTATCGCCAAGCGGTAAGGCACGGGACTTTGACTCCCGCATCGTAGGTTCAAATCC |
Downstream region at tRNA end position |
gcgattcacc |
Secondary structure (Cloverleaf model) | >WENV170646066 Gln TTG t GCCA gcgattcacc T - A G - C G - C G - C G - C T - A A - T T A T C G T C C A G A C | + | | | A C A C C G G T A G G C G | | | T T G A G G C T A A CATC C - G G - C G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |