Sequence ID | >WENV170646068 |
Genome ID | JQGF01031951 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 160 |
End posion on genome | 87 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gcagcgatgc |
tRNA gene sequence |
TGGGGAATAGTTTAATGGTAGAACGACGGACTCTGACTCCGTTAGTCTTGGTTCGAATCC |
Downstream region at tRNA end position |
actttacaag |
Secondary structure (Cloverleaf model) | >WENV170646068 Gln CTG c GCCA actttacaag T - A G - C G - C G - C G - C A - T A - T T A T G G A C C A A A A | + | | | G T T T T G C T T G G C G + | | | T T G G A A C T A G TAGT A - T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |