Sequence ID | >WENV170646070 |
Genome ID | JQGF01033827 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 80 |
End posion on genome | 7 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tcgccccgat |
tRNA gene sequence |
GGCCGGATGGCGGAGCGGTTACGCGGCGGAGTGCATATCCGTCCAGCCTGGTTCGATTCC |
Downstream region at tRNA end position |
tcggggnnnn |
Secondary structure (Cloverleaf model) | >WENV170646070 Cys GCA t TCCA tcggggnnnn G - C G - C C - G C - G G - C G - C A - T T T T G G A C C A G A G | | | | | G C G G C G C C T G G C G | | | T T G A C G C T T G CCAG G + T C - G G - C G - C A - T G A T T G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |