Sequence ID | >WENV170646071 |
Genome ID | JQGF01034557 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 183 |
End posion on genome | 108 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gcacaacgag |
tRNA gene sequence |
GCCAGCTTAGCTCAGTCGGTAGAGCACTTGATTTGTAATCAGGCGGTCGCCGGTTCGATT |
Downstream region at tRNA end position |
cagaacagct |
Secondary structure (Cloverleaf model) | >WENV170646071 Thr TGT g TCCA cagaacagct G - C C - G C - G A - T G - C C - G T - A T T T C G G C C A T G A A | | | | | G C C T C G G C C G G C G | | | | T T G G A G C T A A CGGTC C - G T + G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |