Sequence ID | >WENV170646072 |
Genome ID | JQGF01035337 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 119 |
End posion on genome | 202 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
taaatatctt |
tRNA gene sequence |
GCGCAGGTGGCGGAGTGGTCAATCGCATCTGACTGTAAATCAGACGGCATTAGCCTACGG |
Downstream region at tRNA end position |
aaaaaaaggc |
Secondary structure (Cloverleaf model) | >WENV170646072 Tyr GTA t ACac aaaaaaaggc G - C C - G G - C C - G A - T G - C G - C T A T C T C C C A T G A G | + | | | G G G G C G G G G G G C G + | | | T T T T C G C C A A A CGGCATTAGCCTAC T - A C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |