Sequence ID | >WENV170646073 |
Genome ID | JQGF01035682 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 74 |
End posion on genome | 150 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcgcgccagt |
tRNA gene sequence |
GGGCGGTTAGCTCAGCGGTTTAGAGCGTCAGGCTCATAACCTGAAGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
tgaacaaaat |
Secondary structure (Cloverleaf model) | >WENV170646073 Met CAT t ACCA tgaacaaaat G - C G - C G - C C - G G + T G - C T - A T A T T G T C C A C G A A | | | | | A G C T C G A C A G G C G | | | | T T T G A G C T T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |