Sequence ID | >WENV170646076 |
Genome ID | JQGF01040193 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 334 |
End posion on genome | 258 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
cgcgctcagt |
tRNA gene sequence |
CGGGGTGTAGCTCAGTCTGGTAGAGCGCTACGTTCGGGACGTAGAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
attgaaaaag |
Secondary structure (Cloverleaf model) | >WENV170646076 Pro CGG t ACCA attgaaaaag C - G G - C G - C G - C G - C T T G - C T A T T G T C C A T G A A + | | | | G C C T C G G C A G G C T | | | | T T G G A G C G T A G AGGTC C - G T - A A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |