Sequence ID | >WENV170646080 |
Genome ID | JQGF01055028 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 199 |
End posion on genome | 124 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gaatgaacat |
tRNA gene sequence |
GACCCATTAGCTCAGTCGGTAGAGCACTTGACTTTTAATCAAGGTGTCCGGAGTTCGACC |
Downstream region at tRNA end position |
aatgaaaaag |
Secondary structure (Cloverleaf model) | >WENV170646080 Lys TTT t ACCA aatgaaaaag G - C A - T C - G C - G C - G A - T T C C C T G C C T C A T G A A | | | | | G C C T C G C G G A G C G | | | | T T G G A G C T A A GTGTC C - G T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |