Sequence ID | >WENV170646087 |
Genome ID | JQGF01059722 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 196 |
End posion on genome | 286 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
agggtatcga |
tRNA gene sequence |
GCCGCCATATCTCAGTTGGTAGAGAGTCTGGCTGTTAATTGTATTCGAGCAGCAACCAGA |
Downstream region at tRNA end position |
tccttttggg |
Secondary structure (Cloverleaf model) | >WENV170646087 Asn GTT a GCat tccttttggg G - C C - G C - G G - C C - G C - G A - T C G T T G T C C A T G A A | | | | | G T C T C T A C A G G C G | | | | T T G G A G A T A G TTCGAGCAGCAACCAGAATGTC T - A C T T + G G + T G + T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |