Sequence ID | >WENV170646089 |
Genome ID | JQGF01060641 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 175 |
End posion on genome | 246 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ggcctgagtc |
tRNA gene sequence |
GGCGCCGTCGCCAAGTGGTAAGGCAGAGGTCTGCAAAACCTCCATCACCGGTTCGACTCC |
Downstream region at tRNA end position |
gacggacgac |
Secondary structure (Cloverleaf model) | >WENV170646089 Cys GCA c TCtc gacggacgac G - C G - C C - G G - C C - G C - G G - C T C T T G G C C A G A C | | | | | G T A C C G A C C G G C G | | | T T G A G G C T A A CATC G - C A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |