Sequence ID | >WENV170646092 |
Genome ID | JQGF01064116 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 161 |
End posion on genome | 75 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tattatttgT |
tRNA gene sequence |
GCCGGGATAGTCTAGTCCGGTAAGGCGCAGGATTCGAAATCCTGTTGAGCGATGCTCGTC |
Downstream region at tRNA end position |
atgatgttta |
Secondary structure (Cloverleaf model) | >WENV170646092 Ser CGA T GTta atgatgttta G - C C - G C - G G - C G - C G - C A - T T A T G G C C C A T G A A | + | | | A C T C T G C T G G G C C | | + | T T G A G G C G T A G TTGAGCGATGCTCGTC C - G A - T G - C G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |