Sequence ID | >WENV170646096 |
Genome ID | JQGF01070969 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 145 |
End posion on genome | 72 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
atagtttctt |
tRNA gene sequence |
GCGGGCGTGGTTCAGTTGGTAGAATGTCTCCTTGCCAAGGAGAAGGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
ttttataaaa |
Secondary structure (Cloverleaf model) | >WENV170646096 Gly GCC t TCtg ttttataaaa G - C C - G G - C G - C G - C C - G G - C T G T T A C C C A T G A G + | | | | G T C T T G G T G G G C G | | | + T T G G A A T T A G AGGTC T - A C - G T - A C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |