Sequence ID | >WENV170646097 |
Genome ID | JQGF01070971 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 197 |
End posion on genome | 125 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gttcagctaa |
tRNA gene sequence |
GGGCGTATAGCTCAGTTGGTAGAGCGCCTGTCTTACACACAGGTGGTCATAGGTTCGAGT |
Downstream region at tRNA end position |
cctttgtagg |
Secondary structure (Cloverleaf model) | >WENV170646097 Val TAC a Atcg cctttgtagg G - C G - C G - C C - G G - C T + G A - T T G T T G T C C A T G A A | + | | | G T C T C G A T A G G C G | | | | T T G G A G C T A G TGGTC C - G C - G T - A G - C T - A C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |