Sequence ID | >WENV170646098 |
Genome ID | JQGF01070971 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 100 |
End posion on genome | 27 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aactcctaaa |
tRNA gene sequence |
GCGGGAGTAGTTCAATTGGTTAGAGCACCGCCCTGTCACGGCGGAAGTTGCGGGTTCGAG |
Downstream region at tRNA end position |
ttatgagttt |
Secondary structure (Cloverleaf model) | >WENV170646098 Asp GTC a Gaat ttatgagttt G - C C - G G - C G - C G - C A - T G - C C G T T G C C C A T A A A + | | | | G T C T T G G C G G G C G | | + | T T G G A G C T T A A AAGTT C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |