Sequence ID | >WENV170646106 |
Genome ID | JQGF01077522 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 57 |
End posion on genome | 132 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cttgcacaaa |
tRNA gene sequence |
GGGAATGTAGCTCAGATGGTAGAGCAGTCGCCTGAAAAGCTTCGTGTCATTGGTTCGATC |
Downstream region at tRNA end position |
aaatttaaag |
Secondary structure (Cloverleaf model) | >WENV170646106 Phe GAA a ACCA aaatttaaag G - C G - C G - C A - T A - T T - A G - C C T T T A A C C A A G A A | | | | | G T C T C G A T T G G C G | | | | T T G G A G C T A A GTGTC G - C T T C T G - C C - G C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |