Sequence ID | >WENV170646107 |
Genome ID | JQGF01077864 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 69 |
End posion on genome | 140 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
attttaaatt |
tRNA gene sequence |
GCGGGAGTAATTCAGTGGTAGAATGCTTCCTTGCCAAGGAAGATGTCGCGAGTTCGAATC |
Downstream region at tRNA end position |
ctttaaagcc |
Secondary structure (Cloverleaf model) | >WENV170646107 Gly GCC t Tttt ctttaaagcc G - C C - G G - C G - C G - C A G G - C T A T T G C T C A G A A + | | | | G T C T T A G C G A G C G | | | | T T G G A A T T A G ATGTC C - G T - A T - A C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |