Sequence ID | >WENV170646108 |
Genome ID | JQGF01081119 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 55 |
End posion on genome | 139 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tgccacttat |
tRNA gene sequence |
GCGAGAGTGGCGGAATTGGCAGACGCACCAGACTTAGGATCTGGCACCGAAAGGTATAGG |
Downstream region at tRNA end position |
ctacaaccta |
Secondary structure (Cloverleaf model) | >WENV170646108 Leu TAG t ACCA ctacaaccta G - C C - G G - C A - T G - C A - T G - C T G T T C C T C A T A A G | | | | | A T G G C G A G G A G C G | | | T T G A C G C C A G A CACCGAAAGGTAT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |