Sequence ID | >WENV170646111 |
Genome ID | JQGF01083734 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 180 |
End posion on genome | 97 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
taaggcttct |
tRNA gene sequence |
GGAGGAGTGGCCCAGCGGCTACGGCACGCGCTTGGAAAGCGCGCGGGAGCAATCCCACGC |
Downstream region at tRNA end position |
atgaacatcg |
Secondary structure (Cloverleaf model) | >WENV170646111 Ser GGA t GCag atgaacatcg G - C G - C A - T G - C G - C A - T G - C T G T T G T C C A C G A G + | | | | G G C C C G G C A G G C G | | | T T C C G G C T A A CGGGAGCAATCCCAC C - G G - C C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |