Sequence ID | >WENV170646112 |
Genome ID | JQGF01084746 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 32 |
End posion on genome | 107 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ccactaattt |
tRNA gene sequence |
AGGGGTATGGTGTCAACGGTTAGCATGGAGGTCTCCAAAACCTTAGGTACGGGTTCGAAT |
Downstream region at tRNA end position |
gattaaactt |
Secondary structure (Cloverleaf model) | >WENV170646112 Trp CCA t GCCA gattaaactt A - T G - C G - C G - C G - C T - A A - T T A T T G T C C A A A C G | | + | | G C T G T G A C G G G C G + | | + T T G G C A T T T A G AGGT G + T A - T G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |