Sequence ID | >WENV170646113 |
Genome ID | JQGF01085658 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 41 |
End posion on genome | 118 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tcacttttct |
tRNA gene sequence |
GTCCCCATCGTCTAGCCCGGTCCAGGACACCGGCCTTTCACGCCGGCAACACCGGTTCAA |
Downstream region at tRNA end position |
aaagacaaat |
Secondary structure (Cloverleaf model) | >WENV170646113 Glu TTC t GCCA aaagacaaat G - C T - A C - G C - G C - G C - G A - T T A T T G G C C A C C G A C | | | | | A C T C T G A C C G G C G + | | | T T G G G A C T C C A A CAAC C - G C - G G - C G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |