Sequence ID | >WENV170646114 |
Genome ID | JQGF01088026 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 81 |
End posion on genome | 157 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
caccatatca |
tRNA gene sequence |
GCGCCTGTAGCTCAATTGGATAGAGCGCAGCCCTGCGGAGGCTGAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
tcgcgcgctg |
Secondary structure (Cloverleaf model) | >WENV170646114 Arg GCG a GCCA tcgcgcgctg G - C C - G G - C C - G C - G T - A G - C T G T C A C C C A T A A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C A T A G AGGTC C - G A - T G - C C - G C - G C A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |