Sequence ID | >WENV170646115 |
Genome ID | JQGF01089172 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 249 |
End posion on genome | 173 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
nnnnnnnnnc |
tRNA gene sequence |
GGCTATGTAGCTCAGTTGGTTAGAGCACCGCATTCATAATGCGGGGGTCACAAGTTCAAG |
Downstream region at tRNA end position |
tttttataga |
Secondary structure (Cloverleaf model) | >WENV170646115 Met CAT c ACCA tttttataga G - C G - C C - G T - A A - T T - A G - C T G T T G C T C A T G A A | | | | A T C T C G A C A A G C G | | | | T T G G A G C T T A A GGGTC C - G C - G G - C C - G A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |