Sequence ID | >WENV170646120 |
Genome ID | JQGF01096894 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 3 |
End posion on genome | 91 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
nnnnnnnncc |
tRNA gene sequence |
CGAGGGGTGTCCGAGTGGTTTATGGTAGCGGTCTTGAAAACCGCCGTCTCGCTCTGCGGG |
Downstream region at tRNA end position |
tttatcttgc |
Secondary structure (Cloverleaf model) | >WENV170646120 Ser TGA c GCtt tttatcttgc C C G - C A - T G - C G - C G - C G - C T A T T A C C C A T G A G | | | | | G G G C C T A T G G G C G + | | T T T T G G T T T A A CGTCTCGCTCTGCGGGACC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |