Sequence ID | >WENV170646122 |
Genome ID | JQGF01099238 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 200 |
End posion on genome | 124 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
caggccacat |
tRNA gene sequence |
GGCGGAATGGAGCAGTTCGGTAGCTCGCCAGCCTCATAAGCTGGAGGTCCCAGGTTCAAA |
Downstream region at tRNA end position |
aacggcctag |
Secondary structure (Cloverleaf model) | >WENV170646122 Met CAT t ACAA aacggcctag G A G - C C - G G - C G - C A - T A - T T A T G G T C C A T G A G | | | | | A T C G A G C C A G G C C | | | | T T G G C T C G T A G AGGTC C - G C - G A - T G - C C - G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |