Sequence ID | >WENV170646126 |
Genome ID | JQGF01103221 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 152 |
End posion on genome | 226 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
atgttgtaaa |
tRNA gene sequence |
GGGACCATAGGGTAGCTTGGTCGATCCTTTGGGCTTTGGGAGCCTGAGACTCCGGTTCAA |
Downstream region at tRNA end position |
aaaacccgcc |
Secondary structure (Cloverleaf model) | >WENV170646126 Pro TGG a Atcc aaaacccgcc G - C G - C G - C A - T C - G C - G A - T T A T G G G C C A T C G A A + | | | | A T T G G G T C C G G C G | | + T T G T C C T T C G A T AGAC T + G G + T G - C G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |