Sequence ID | >WENV170646128 |
Genome ID | JQGF01104295 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 20 |
End posion on genome | 94 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gcggtcgcga |
tRNA gene sequence |
GCCAGAGTAGCTCAGCGGTAGAGCAGGCGATTCGTAATCGTCAGGTCAAGGGTTCAATCC |
Downstream region at tRNA end position |
gaaactgaaa |
Secondary structure (Cloverleaf model) | >WENV170646128 Thr CGT a TCCA gaaactgaaa G - C C - G C - G A - T G - C A - T G - C C T T T T C C C A G A A | | | | | A C C T C G A A G G G C G | | | | T T G G A G C T A A AGGTC G - C G + T C - G G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |