Sequence ID | >WENV170646130 |
Genome ID | JQGF01105187 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 105 |
End posion on genome | 178 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
agcgttccga |
tRNA gene sequence |
GCGGGCGTCGTATAATGGTAATACCCTAGCTTCCCAAGCTAGAGCCGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tccggaatcg |
Secondary structure (Cloverleaf model) | >WENV170646130 Gly CCC a TCCA tccggaatcg G - C C - G G - C G - C G - C C - G G - C T T T T A C C C A A A C + | | | | G T T A T G G T G G G C G | | | | T T G A T A C T A C AGCC C - G T - A A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |