Sequence ID | >WENV170646131 |
Genome ID | JQGF01111382 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 246 |
End posion on genome | 319 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
actgccgtcc |
tRNA gene sequence |
GCCCCCATCGTCTAGAGGACCAGGACACAGGCCTTTCAAGCCTGGTGCAGGGGTTCGAAT |
Downstream region at tRNA end position |
ttttatgtta |
Secondary structure (Cloverleaf model) | >WENV170646131 Glu TTC c ACtg ttttatgtta G - C C - G C - G C - G C - G C - G A - T T A T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T A G G A C C C A A GTGC C - G A - T G - C G - C C - G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |