Sequence ID | >WENV170646132 |
Genome ID | JQGF01112198 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 121 |
End posion on genome | 195 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tttctggcgc |
tRNA gene sequence |
GCCGGGATAGGGTAGTGGCTATCCTGAGGGACTGTGGATCCCTCGAGCTGGGTTCGAATC |
Downstream region at tRNA end position |
aattgtctga |
Secondary structure (Cloverleaf model) | >WENV170646132 His GTG c CCCT aattgtctga G - C C - G C - G G - C G - C G - C A - T T A T G G C C C A T G A A | + | | | G G T G G G C T G G G C G | | + T T C T C C T T A G CGAG A - T G - C G - C G - C A - T C A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |