Sequence ID | >WENV170646134 |
Genome ID | JQGF01113002 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 48 |
End posion on genome | 125 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttaacggtat |
tRNA gene sequence |
GGCCTATGAGACTGCTTGGTGTGGTCGCTACACTGTCACTGTAGATATCGGTCGGTTCAA |
Downstream region at tRNA end position |
aagttataac |
Secondary structure (Cloverleaf model) | >WENV170646134 Asp GTC t GCCA aagttataac G - C G + T C - G C - G T - A A - T T - A T A G C A G C C A T C G A | | | | | A T T C A G G T C G G C G + | | | T T G G G T C T G T G ATATCG C - G T - A A - T C - G A - T C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |