Sequence ID | >WENV170646137 |
Genome ID | JQGF01115169 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 260 |
End posion on genome | 188 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
nnnnnnnnna |
tRNA gene sequence |
GTCCCTGTAGCGCAATGGACAGCGTACCGGCCTCCGAAGCCGTAGGTGAGAGTTCGAGTC |
Downstream region at tRNA end position |
gcattcataa |
Secondary structure (Cloverleaf model) | >WENV170646137 Arg CCG a ACac gcattcataa G - C T - A C - G C - G C - G T - A G - C T G T C T C T C A T A A A | | | | | G G C G C G G A G A G C G | | | + T T A G C G T C A A AGGT C T C - G G - C G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |