Sequence ID | >WENV170646143 |
Genome ID | JQGG01000579 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 2106 |
End posion on genome | 2033 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ggtaaagctt |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGAAGTTTTCCAAACTTACGACGAGGGTTCGATCCC |
Downstream region at tRNA end position |
gtttgatttg |
Secondary structure (Cloverleaf model) | >WENV170646143 Gly TCC t TCCA gtttgatttg G - C C - G G - C G - C G - C T - A G - C C T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A CGAC G A A - T A - T G - C T - A T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |