Sequence ID | >WENV170646145 |
Genome ID | JQGG01001057 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 116 |
End posion on genome | 190 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gtccgcacgc |
tRNA gene sequence |
GTCCCCATAGTTCAATGGATAGAACGGGGTCCTCCTAAGACCCAGATGCAGGTTCGATTC |
Downstream region at tRNA end position |
catcccgcaa |
Secondary structure (Cloverleaf model) | >WENV170646145 Arg CCT c ACCA catcccgcaa G - C T - A C - G C - G C - G C - G A - T T T T C G T C C A T A A A | | | | | G G C T T G G C A G G C G | | | | T T A G A A C T A G AGAT G - C G - C G - C T - A C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |