Sequence ID | >WENV170646146 |
Genome ID | JQGG01001206 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 1353 |
End posion on genome | 1278 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gcccttgatc |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCATGGCATGCAGGAGGTCGACGGTTCGATC |
Downstream region at tRNA end position |
ccttccccac |
Secondary structure (Cloverleaf model) | >WENV170646146 Ala GGC c ACCA ccttccccac G - C G - C G + T G - C C - G C - G A - T C T T C T G C C A C G A A | | | | | G T C T C G G A C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |